SKU: 45637918893

S. pyogenes Cas9 NLS

Sale price$306.00 Regular price$340.00
Save 10%

Pay in installments of $85.00 with ShopPay, AfterPay and Klarna

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Sep 5 - Sep 10

Promo Codes Available:

For Your Every Summer RSVP, with Code: SUMMER15

Description

S. pyogenes Cas9 NLSProduct Specification Amino Acid Sequence

Product Specification


Amino Acid Sequence

APKKKRKVGIHGVPAADKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDKRPAATKKAGQAKKKK

Expression System E.coli
Molecular Weight

The recombinant SpCas9 NLS consists of 1399 amino acids and has a predicted molecular mass of 161.7 kDa.

Purity ≥ 97% by SDS-PAGE gel analyses.
Endotoxin <0.1EU/μg
Tag No Tag
Physical Appearance Liquid
Storage Buffer

10 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.1 mM EDTA, 1.0 mM TCEP, 50% glycerol.

Stability & Storage

Please use a manual defrost freezer and avoid repeated freeze-thaw cycles.

24 months from date of receipt, -20 to -70 °C as supplied.

12 months, -20 to -70 °C under sterile conditions after opening.

Protocol

Activity Assay Protocol

Materials

Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9

Recombinant S. pyogenes Cas9 NLS

DNA Substrate: PBR322 vector digested with EcoRI Synthetic sgRNA, targeting sequence:, targeting sequence: GAGGCAGACAAGGTATAGGG

Ethidium Bromide, 10 mg/mL

Ultrapure DNase/RNase-Free Distilled Water, to prepare Assay Buffer

Assay

1. Prepare RNP Complex:

a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)

b. 0.25μg rSpCas9 NLS

c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL

d. Incubate for 5 minutes at 37 °C.

2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).

3. Incubate for 1 hour at 37 °C.

4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.

5. Load total reaction with loading dye on a 1% agarose gel.

6. Run gel at 140 V for 40 minutes.

7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.

8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.

Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy
SKU: 45637918893

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

4.5 ★★★★★
Based on 9 reviews
Sort
Highest Rating
Newest First
Oldest First
Product Reviews
W
Verified Purchase
Wesley
New York, US
★★★★★ 5
Quality No Show Socks That Are Comfortable and Durable
Size: Large, Color: (100) White / White / Black
These Under Armour no show socks are great for everyday training and casual wear. The cotton blend feels comfortable and they stay in place throughout the day. Getting six pairs in a pack is solid value for a quality brand. They hold up well after multiple washes and the no show style works great with most athletic shoes. A reliable go-to sock.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on April 30, 2026
H
Verified Purchase
Hanson
Cuba, US
★★★★★ 5
Comfortable
Size: Large, Color: (001) Black / Black / White
I recently picked up a pair of Under Armour socks, and they’ve quickly become my go-to choice for daily wear and workouts. From the first wear, the fit felt snug and supportive without being too tight. The fabric is lightweight yet durable, and it does a great job wicking sweat — keeping my feet dry even during longer runs or intense gym sessions. One of the things I appreciate most is the arch support and cushioning in the right places. It adds just enough padding where I need it, especially under the ball and heel of the foot, which makes a noticeable difference on days when I’m on my feet a lot. The socks also have a nice breathable mesh pattern that improves airflow.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on January 4, 2026
R
Verified Purchase
Renell Ridgell
Birmingham, US
★★★★★ 5
Perfect red patent purse .
Color: Red, Color: Red
Just the right size and the color red match perfect.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on April 10, 2026
C
Verified Purchase
cleburton
Port Orchard, US
★★★★★ 5
Beautiful!
Color: Black
Beautiful patent leather, perfect size
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on August 23, 2025
R
Verified Purchase
Robin
Omaha, US
★★★★★ 5
Quality bag
Color: Black
Happy with this evening bag! Quality product and roomy. Will go with my patent sandals for wedding.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on March 24, 2026

recommand products